View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_high_24 (Length: 319)
Name: NF5165_high_24
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 19 - 313
Target Start/End: Complemental strand, 26517596 - 26517302
Alignment:
| Q |
19 |
ttagtttcccagtctgctcatggaataaaatggtcgtcaatatcactttaataagccataagaacaaaacttttttgcaaatgaaatttagctatgcata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26517596 |
ttagtttcccagtctgctcatggaataaaatggtcgtcaatatcactttaataagccataagaacaaaacttttttgcaaatgaaatttagctatgcata |
26517497 |
T |
 |
| Q |
119 |
ccgatgtatactcggggtcaaaatacccaaatgtgccgagtactccggcagttacatgtatctcttgtccttcttgcattagctttgcaaacccgaaatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26517496 |
ccgatgtatactcggggtcaaaatacccaaatgtgccgagtactccggcagttacatgtatctcttgtccttctggcattagctttgcaaacccgaaatc |
26517397 |
T |
 |
| Q |
219 |
tgatatctacaaaatggttgttgatttttactcatagaagattatggatagtaaacacgacgttgttaggagttaagtatttgtacctttgcttc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26517396 |
tgatatctacaaaatggttgttgatttttactcatagaagattatggatagtaaacacgacgttgttaggagttaagtatttgtacctttgcttc |
26517302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 112 - 230
Target Start/End: Complemental strand, 15243786 - 15243668
Alignment:
| Q |
112 |
atgcataccgatgtatactcggggtcaaaatacccaaatgtgccgagtactccggcagttacatgtatctcttgtccttcttgcattagctttgcaaacc |
211 |
Q |
| |
|
||||||||||||||||||||||| ||||| || |||||||||||||| |||| |||||| || ||| |||| ||||||||| |||||| ||| |||| || |
|
|
| T |
15243786 |
atgcataccgatgtatactcgggatcaaagtaaccaaatgtgccgaggactctggcagtcacgtgtgtctcctgtccttctggcattaacttggcaagcc |
15243687 |
T |
 |
| Q |
212 |
cgaaatctgatatctacaa |
230 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
15243686 |
cgaaatcagatatctacaa |
15243668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University