View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_high_25 (Length: 317)
Name: NF5165_high_25
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_high_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 243 - 303
Target Start/End: Complemental strand, 45918650 - 45918590
Alignment:
| Q |
243 |
ccaacttcagtgaagtaaggaagtacaccacccaacttcgagaaattatgcattctttctg |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45918650 |
ccaacttcagtgaagtaaggaagtacaccacccaacttcgagaaattatgcattctttctg |
45918590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 202 - 233
Target Start/End: Complemental strand, 45918718 - 45918687
Alignment:
| Q |
202 |
atcacactatacgcaccatgtggaaagcattg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45918718 |
atcacactatacgcaccatgtggaaagcattg |
45918687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University