View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_high_26 (Length: 312)
Name: NF5165_high_26
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 199 - 307
Target Start/End: Complemental strand, 26610164 - 26610056
Alignment:
| Q |
199 |
ggattggaaccgcaagagcaattttaccaaattattatgttgtttatgttttacattttgtgtcacattgaaaccacttatttggtttggtatacttagg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26610164 |
ggattggaaccgcaagagcaattttaccaaattattatattgtttatgttttagactttgtgtcacattgaaaccacttatttggttttgtatacttagg |
26610065 |
T |
 |
| Q |
299 |
tctcttgtt |
307 |
Q |
| |
|
||||||||| |
|
|
| T |
26610064 |
tctcttgtt |
26610056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 8016644 - 8016561
Alignment:
| Q |
1 |
atgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttattattattgacatgatgatgatgat |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8016644 |
atgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttat---tattgacatgatgatgatgat |
8016561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University