View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_high_32 (Length: 264)
Name: NF5165_high_32
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 9 - 258
Target Start/End: Complemental strand, 6486176 - 6485927
Alignment:
| Q |
9 |
caagaatattgcggattcaaatccaacagtggactggtgaaagcaatcataatatccggtcaaaagatcttcactggtcaccaagacggtaaaatccgtg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486176 |
caagaatattgcggattcaaatccaacagtggactggtgaaagcaatcataatatccggtcaaaagatcttcactggtcaccaagacggtaaaatccgtg |
6486077 |
T |
 |
| Q |
109 |
tttggaaagtttctctcaagaaccctagcgttcacaaacgtgccggaacattaccaacactcaaagacatcttcaaaagctcgattaaaccaagcaatta |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6486076 |
tttggaaagtctctctcaagaaccctagcgttcacaaacgtgctggaacattaccaacactcaaagacatcttcaaaagctcaattaaaccaagcaatta |
6485977 |
T |
 |
| Q |
209 |
tgtcgaggttagaaaacaccgaactgcattatggatcaaacattcggatg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485976 |
tgtcgaggttagaaaacaccgaactgcattatggatcaaacattcggatg |
6485927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University