View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_high_34 (Length: 256)
Name: NF5165_high_34
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 238
Target Start/End: Original strand, 37968145 - 37968371
Alignment:
| Q |
12 |
atgaatatcggggaaggtgtccagcagctggttctaggtttatacatcattaggggtgacaacatgtatgcctgattctccgatatattttcaattttat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37968145 |
atgaatatcggggaaggtgtccagcagctggttctaggtttatacatcattaggggtgacaacatttatgcctgattctccgatatattttcaattttat |
37968244 |
T |
 |
| Q |
112 |
ctattctggagaccccgtcttttaacaccataaccctactcgtttagattttacagaactgttgttggcaaactggatgaagatctagattccagcctag |
211 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37968245 |
ctattctggagaccccgtctttttacaccataaccctactcgtttggattttgcagaactgttgttggcaaactggatgaagatctagattccagcctag |
37968344 |
T |
 |
| Q |
212 |
atttgtccaagcttagagctcatccct |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37968345 |
atttgtccaagcttagagctcatccct |
37968371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 23 - 81
Target Start/End: Original strand, 33148491 - 33148549
Alignment:
| Q |
23 |
ggaaggtgtccagcagctggttctaggtttatacatcattaggggtgacaacatgtatg |
81 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33148491 |
ggaaggtgttcagcagcttgttctgggtttatacatcattaggggtgacaacatgtatg |
33148549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 152 - 238
Target Start/End: Original strand, 33148638 - 33148724
Alignment:
| Q |
152 |
cgtttagattttacagaactgttgttggcaaactggatgaagatctagattccagcctagatttgtccaagcttagagctcatccct |
238 |
Q |
| |
|
||||| |||||| ||||| |||||||| || ||||||| || |||||||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
33148638 |
cgtttggattttgcagaagcgttgttggtgaattggatgaggaactagattctagcctagacttgtcccagcttagagctcatccct |
33148724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University