View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_high_42 (Length: 250)
Name: NF5165_high_42
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_high_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 15687655 - 15687398
Alignment:
| Q |
1 |
ataagtgcttatgcttttatgcaaaccccttgtttttactttaaaatgtcatatttcattggtcatgtatacattaatagattcaattcacgtttcataa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
15687655 |
ataagtgcttattcttttatgcaaaccccttgtttttactttaaaatgtcatatttcattggtcatgtatacattaatagattcaattcacgtttcggaa |
15687556 |
T |
 |
| Q |
101 |
aatagatcttccagattcacaatttgaatatcgact--------------atggttgtcaagtacaccattagaatatattacaacatgaaattaggagt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15687555 |
aatagatcttccagattcacaatttgaatatcgacttgataatgacaaccatggttgtcaagtacaccattagaatatattacaacatgaaattaggagt |
15687456 |
T |
 |
| Q |
187 |
acccttgtttcagagctatttatatgatgatgttaaatctgttttatgttctctgttc |
244 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15687455 |
acctttgtttcagagctatttatatgatgatgttaaatctgttttatgttctctgttc |
15687398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University