View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_high_46 (Length: 244)
Name: NF5165_high_46
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_high_46 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 961350 - 961138
Alignment:
| Q |
18 |
atgcaaaagtataggcaggcacgtatggtacgcggagtannnnnnncttcttcttatgacaatcaagttttatgtgtagtttcattaatgtaacaacaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
961350 |
atgcaaaagtataggcaggcacgtatggtacgcggagtatttttt--ttcttcttatgacaatcaatttttatgtgtagtttcatt---gtaacaacaaa |
961256 |
T |
|
| Q |
118 |
gattcttttttaagggatcattgttatcaaagataaactcttcatgtcttcaaaggttggtcaaagcagcaaatgactgcttgtatttttggatgagcat |
217 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
961255 |
gattctt---------atcattgctatcaaagataaactcttcatgtcttcaaaagttggtcaaagaagcaaatgactgcttgtatttttggatgagcat |
961165 |
T |
|
| Q |
218 |
gtcaaaattacggcgatacgataattt |
244 |
Q |
| |
|
||||||||||||| ||||| ||||||| |
|
|
| T |
961164 |
gtcaaaattacggtgatactataattt |
961138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University