View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_high_56 (Length: 226)
Name: NF5165_high_56
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_high_56 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 52341651 - 52341432
Alignment:
| Q |
7 |
tttacgaatcaccggatccttatagaatcaaaactctttttagtatttaagaatgatacagaaaaattattttgtgggagaaactcatggattagagctc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52341651 |
tttacgaatcaccggatccttatagaatcaaaactctttttagtatttaagaatgatacagaaaaattatattgtgggagaaactcatggattagagctc |
52341552 |
T |
|
| Q |
107 |
atggacaggaacagtcacgtaagtagattttgtcattgaagtcttctgggaattaaagagtggcaattaaagagggatatttgagaatatgttggggagg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
52341551 |
atggacaggaacagtcacgtaagtagattttgtcattgaagctttctgggaattaaagagtggcaactaaagagggatatttgagaatatgttggggaag |
52341452 |
T |
|
| Q |
207 |
gaaatccaaaagcggatcat |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
52341451 |
gaaatccaaaagcggatcat |
52341432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University