View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_high_64 (Length: 213)
Name: NF5165_high_64
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_high_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 9939842 - 9940051
Alignment:
| Q |
1 |
gtataatcgatggtgttggtgattgctaccnnnnnnntgtcgataccatacccaacataatagacgagtataatacctctatacttcaacaacaaaatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9939842 |
gtataatcgatggtgttggtgattgctacgaaaaaaatgtcgataccatacccaacataatagacgagtataatacctctatacttcaacaacaaaatta |
9939941 |
T |
 |
| Q |
101 |
attttaacatttatgtcgttacgatcaagacaacaatagttaaaacatatattagagttgtctaacatcacgtagatgtcttttaaatcaaagctataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9939942 |
attttaacatttatgtcgttacgatcaagacaacaatagttaaaacatatattagaattgtctaccatcacgtagatgtcttttaaatcaaagctataat |
9940041 |
T |
 |
| Q |
201 |
acttactaag |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
9940042 |
acttactaag |
9940051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University