View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_high_66 (Length: 208)
Name: NF5165_high_66
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_high_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 193
Target Start/End: Original strand, 52592817 - 52592988
Alignment:
| Q |
20 |
aaaatatgcatagcatatatattaggctcaaaaatatgcatagcatattatgtgaccagtgtaatttcaaccataaaaaacaaagcatttcaagcatata |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52592817 |
aaaatatgcatagcatat--attaggctcaaaaatatgcatagcatattatgtgaccagtgtaatttcaaccataaaaaacaaagcatttcaagcatgta |
52592914 |
T |
 |
| Q |
120 |
agaacataatttatttgtataatggattgttccctgtttggttatcatttattcaaatccgggtttttgatatt |
193 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592915 |
agaacagaatttatttgtataatggattgttccctgtttggttatcatttattcaaatccgggtttttgatatt |
52592988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University