View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_high_67 (Length: 206)
Name: NF5165_high_67
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_high_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 47 - 189
Target Start/End: Complemental strand, 38432753 - 38432610
Alignment:
| Q |
47 |
agacgacccatacttcaagcaaagttattaagacttttaaaacttgatttattgtgttcaaaatctaagtt-ttttgactaaagatcgaactatatgaag |
145 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
38432753 |
agacgactcatacttcaagcaaacttattaagacttttaaaacttgatttattgtgttcaaaatctaagtttttttgactaaagatcgaactatgtgaag |
38432654 |
T |
 |
| Q |
146 |
atgtcaacggtgtgaatgcaaaaaatcttaatctaagttgttca |
189 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38432653 |
atgtcaatggtgtgaatgcaaagaatcttaatctaagttgttca |
38432610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University