View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_high_9 (Length: 435)
Name: NF5165_high_9
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 10 - 419
Target Start/End: Original strand, 21970490 - 21970890
Alignment:
| Q |
10 |
catcatcatccaaatagttattatcatgcaatctcaactcatcactcaaactagtactacaactcactcttgcatttgcattagcattaacattatcact |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21970490 |
catcatcatccaaatagttattatcatgcaatctcaactcatcactcaaactagtactacaactcactcttgcatttgcattagcattaacattatcatt |
21970589 |
T |
 |
| Q |
110 |
tttcttaaaaattgaaccttttccaaaagatactgcattagaaaaaaccctactaagaactttcttcaagctgatcttattaggcttgttcatcttcatt |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21970590 |
tttcttaaaaaatgaaccttttccaaaagatactgcattagagaaaaccctaccaagaaccttcttcaagctgatcttattaggcttgttcaccttcatt |
21970689 |
T |
 |
| Q |
210 |
tgttctaaacatttctcaatggaattagcattaaacacacgatcgaaaggactcgaagataacccttcttcaacggaggtacacacagaagaggtacgag |
309 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
21970690 |
tgttctaaacatttctcaatggaattagaattaaacacacgatcgaaaggactcgaagataacccttcttcaatggaagtacacacagaagaggtacgag |
21970789 |
T |
 |
| Q |
310 |
gagcatgctgattttgatattgagaatgtttaggatgcatcattggggaagtaaaggaaccaaagctttcaaaagaagcagatgaatccaaaacagtgct |
409 |
Q |
| |
|
|| |||| ||||||| ||||| |||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21970790 |
gattatgcggattttggtattg---------aggatgcatcattgtggaagtaaaggaaccaaagctctcaaaagaagcagatgaatccaaaacagtgct |
21970880 |
T |
 |
| Q |
410 |
atgttgaaga |
419 |
Q |
| |
|
|||||||||| |
|
|
| T |
21970881 |
atgttgaaga |
21970890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University