View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5165_low_27 (Length: 317)

Name: NF5165_low_27
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5165_low_27
NF5165_low_27
[»] chr7 (2 HSPs)
chr7 (243-303)||(45918590-45918650)
chr7 (202-233)||(45918687-45918718)


Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 243 - 303
Target Start/End: Complemental strand, 45918650 - 45918590
Alignment:
243 ccaacttcagtgaagtaaggaagtacaccacccaacttcgagaaattatgcattctttctg 303  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45918650 ccaacttcagtgaagtaaggaagtacaccacccaacttcgagaaattatgcattctttctg 45918590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 202 - 233
Target Start/End: Complemental strand, 45918718 - 45918687
Alignment:
202 atcacactatacgcaccatgtggaaagcattg 233  Q
    ||||||||||||||||||||||||||||||||    
45918718 atcacactatacgcaccatgtggaaagcattg 45918687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University