View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_low_45 (Length: 248)
Name: NF5165_low_45
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_low_45 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 10 - 248
Target Start/End: Original strand, 246884 - 247124
Alignment:
| Q |
10 |
aatatagtaaacatagtgt--ttattttctggtggtgatggaggtatacgtatgatattacattagttcattttgaatgctatccactccgaccacaata |
107 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
246884 |
aatatagtaaacatagtgtatttattttctggtggtgatggaggtatacgtatgatattacattagttcattttgaatgccatccactccgaccacaata |
246983 |
T |
 |
| Q |
108 |
gctagcaataacatgaattagaaaacatgattagtttctgaagtaacaggtctcggagaaggtggcagcgccatcaggaacatcttccattacccattca |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
246984 |
gctagcaataacatgaattagaaaacatgattagtttctgaagtaacaggtctcggagaaggtggcagcaccatcaggaacatcttccattacccattca |
247083 |
T |
 |
| Q |
208 |
tggccaacagggaagtaaattccagtccttgggtgtggaac |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
247084 |
tggccaacagggaagtaaattccagtccttgggtgtggaac |
247124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University