View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_low_50 (Length: 240)
Name: NF5165_low_50
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 32606159 - 32605980
Alignment:
| Q |
1 |
ctattacatgtatctaaatcttttaaggacaaaaattagggacggaaatcggaagggtagtaaattttgtaatattgattgatataattaccacactccg |
100 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32606159 |
ctattacatgtatctaaatcttt-acggacaaaaattagggacggaaatcggaagggtagtaaattttgtaatattgattgatataattaccacactccg |
32606061 |
T |
 |
| Q |
101 |
acaagattttagcatgagattctatttctgcatgttcaattcaataagagttacgatacatatacaatcttaggtgacaata |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||||| || |||| ||||||||||||| ||||| |
|
|
| T |
32606060 |
acaagattttagcatgagattctatttctgtaggttcaattcaataagagttactat-catagacaatcttaggtggcaata |
32605980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University