View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_low_51 (Length: 237)
Name: NF5165_low_51
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_low_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 36483422 - 36483206
Alignment:
| Q |
1 |
caacgactacgaatacagtcaaacaaacacggtattacaaaaaacgaaaattgattgnnnnnnnnnnngtggaggagattgagattgaattacggagtgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36483422 |
caacgactacgaatacagtcaaacaaacacggtattacaaaaaacgaaaattgattgaaaaaaaaaaagtggaggagattgagattgaattacggagtgg |
36483323 |
T |
|
| Q |
101 |
atgattggaagaaggagtttatcgaatgaacggttgtgattaacggcgtcggtgacgtaggtctggaagaagcgtagagaatcgtggagagaggcggttg |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36483322 |
atgattggaagaaggagttgatcgaatgaacggttgtgattaacggcgtcggtgacgtaggtgtggaagaagcgtagagaatcgtggagagaggcggttg |
36483223 |
T |
|
| Q |
201 |
gagaaggtgaatgtgat |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36483222 |
gagaaggtgaatgtgat |
36483206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University