View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_low_57 (Length: 227)
Name: NF5165_low_57
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_low_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 2 - 222
Target Start/End: Original strand, 247167 - 247385
Alignment:
| Q |
2 |
cttccctaaactactactctttgtcttttgatcaaccagcagctgcttcgacccaacttctcttcctaagtatctgcagatcccagtagtattctccgct |
101 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
247167 |
cttccctaaactaccactctttgtcttttgatcaaccagcagctgcttcgacccaacttctcttcctaagtatctgcagatcccagtagtattctccgct |
247266 |
T |
 |
| Q |
102 |
cccttagccgttctcctgtacccggtattatagtagtaagtataagtttcattcactcagaattgtgttacaccaatattgattaatttcatcattaatt |
201 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
247267 |
cccttagctgttctcctgcacccggtattatagtagtaag--taagtttcattcactcagaattgtgttacaccaatattgattaatttcatcattaatt |
247364 |
T |
 |
| Q |
202 |
cattaaaggaaggagtaagtt |
222 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
247365 |
cattaaaggaaggagtaagtt |
247385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University