View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5165_low_61 (Length: 218)
Name: NF5165_low_61
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5165_low_61 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 2 - 218
Target Start/End: Original strand, 45208663 - 45208879
Alignment:
| Q |
2 |
atgttatgcttttgtacatgttcatgatagagcgcctaaattttagttttcatagctgtaaaatttagaatataaagttaaaaagatggaaagaggaaag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45208663 |
atgttatgcttttgtacatgttcatgatagaccgcctaaattttagttttcatagttgtaaaatttagaatataaagttaaaaagatggaaagaggaaag |
45208762 |
T |
|
| Q |
102 |
agttgaataatttgtatttatcaaataatgtgtgtgtggaaaccctacaaaacccctctgccaaatagaccctaagcatatgtgcaaagtaccaacaata |
201 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45208763 |
agttgaataatgagtatttatcaaataatgtgtgtgtggaaaccctacaaaacccctctgccaaatagaccctaagcatatgtgcaaagtagcaacaata |
45208862 |
T |
|
| Q |
202 |
tgaacgaggtcatcatc |
218 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45208863 |
tgaacgaggtcatcatc |
45208879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University