View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5165_low_64 (Length: 213)

Name: NF5165_low_64
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5165_low_64
NF5165_low_64
[»] chr2 (1 HSPs)
chr2 (14-198)||(42072416-42072600)


Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 14 - 198
Target Start/End: Complemental strand, 42072600 - 42072416
Alignment:
14 gagcagagaactgagaaacaggggaaggagatggaaatctagctttagctgggcctggacttgggcttgggctatttccttgagttaatgcagcatgaag 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42072600 gagcagagaactgagaaacaggggaaggagatggaaatctagctttagctgggcctggacttgggcttgggctatttccttgagttaatgcagcatgaag 42072501  T
114 ggctcttaactcaactgctttagctatggcagtttgaatttcttgtctgttaagctcattgttgttttgttgaaaaggttgttgt 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42072500 ggctcttaactcaactgctttagctatggcagtttgaatttcttgtctgttaagctcattgttgttttgttgaaaaggttgttgt 42072416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University