View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5165_low_66 (Length: 213)

Name: NF5165_low_66
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5165_low_66
NF5165_low_66
[»] chr7 (1 HSPs)
chr7 (1-210)||(9939842-9940051)


Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 9939842 - 9940051
Alignment:
1 gtataatcgatggtgttggtgattgctaccnnnnnnntgtcgataccatacccaacataatagacgagtataatacctctatacttcaacaacaaaatta 100  Q
    |||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9939842 gtataatcgatggtgttggtgattgctacgaaaaaaatgtcgataccatacccaacataatagacgagtataatacctctatacttcaacaacaaaatta 9939941  T
101 attttaacatttatgtcgttacgatcaagacaacaatagttaaaacatatattagagttgtctaacatcacgtagatgtcttttaaatcaaagctataat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||    
9939942 attttaacatttatgtcgttacgatcaagacaacaatagttaaaacatatattagaattgtctaccatcacgtagatgtcttttaaatcaaagctataat 9940041  T
201 acttactaag 210  Q
    ||||||||||    
9940042 acttactaag 9940051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University