View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5165_low_69 (Length: 206)

Name: NF5165_low_69
Description: NF5165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5165_low_69
NF5165_low_69
[»] chr5 (1 HSPs)
chr5 (47-189)||(38432610-38432753)


Alignment Details
Target: chr5 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 47 - 189
Target Start/End: Complemental strand, 38432753 - 38432610
Alignment:
47 agacgacccatacttcaagcaaagttattaagacttttaaaacttgatttattgtgttcaaaatctaagtt-ttttgactaaagatcgaactatatgaag 145  Q
    ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||    
38432753 agacgactcatacttcaagcaaacttattaagacttttaaaacttgatttattgtgttcaaaatctaagtttttttgactaaagatcgaactatgtgaag 38432654  T
146 atgtcaacggtgtgaatgcaaaaaatcttaatctaagttgttca 189  Q
    ||||||| |||||||||||||| |||||||||||||||||||||    
38432653 atgtcaatggtgtgaatgcaaagaatcttaatctaagttgttca 38432610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University