View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5166-Insertion-7 (Length: 280)
Name: NF5166-Insertion-7
Description: NF5166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5166-Insertion-7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 8 - 280
Target Start/End: Original strand, 8459046 - 8459318
Alignment:
| Q |
8 |
ggtcttgcagccgttgcttcgaccggaggtgaagcatcacttgtagcattgaaagtttcttccacaattctttacatggctgcaactggtttacttctgt |
107 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8459046 |
ggtcttgcagcggttgcttcgaccggaggtgaagcatcacttgtagcattgaaagtttcttccacaattctttacatggctgcaactggtttacttctgt |
8459145 |
T |
|
| Q |
108 |
tcatgaacaaagttcagccgtcgcagcttgcagaagaacaaagaaatgctactagattttttaagcagcttcaaggagaggtaagaacaaagcttgctct |
207 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8459146 |
tcatgaacaaagttcagccatcgcagcttgcagaagaacaaagaaatgctactagattttttaagcagcttcaaggagaggtaagaacaaagcttgctct |
8459245 |
T |
|
| Q |
208 |
tgggaattttagtgaagctgatgtcaatgaagcaatgaagaaagttttggcattggataaagcttaccctctt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8459246 |
tgggaattttagtgaagctgatgtcaatgaagcaatgaagaaagttttggcattggataaagcttaccctctt |
8459318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 59 - 157
Target Start/End: Complemental strand, 1617908 - 1617810
Alignment:
| Q |
59 |
aaagtttcttccacaattctttacatggctgcaactggtttacttctgttcatgaacaaagttcagccgtcgcagcttgcagaagaacaaagaaatgct |
157 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||||||| | ||||| || ||||||| ||| ||||| |||||||| |
|
|
| T |
1617908 |
aaagtttcttccacaattctttatatgtctgcaactgctttacttctgttcatgaacaaaatccagccatcccagcttgtagaggaacagggaaatgct |
1617810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 91 - 157
Target Start/End: Complemental strand, 18790886 - 18790820
Alignment:
| Q |
91 |
aactggtttacttctgttcatgaacaaagttcagccgtcgcagcttgcagaagaacaaagaaatgct |
157 |
Q |
| |
|
||||||||||||||||||||| |||||| | ||||| || ||||||| ||| ||||| |||||||| |
|
|
| T |
18790886 |
aactggtttacttctgttcataaacaaaatccagccatcacagcttgtagaggaacagggaaatgct |
18790820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University