View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5166-Insertion-8 (Length: 228)
Name: NF5166-Insertion-8
Description: NF5166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5166-Insertion-8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 8 - 228
Target Start/End: Original strand, 30340818 - 30341038
Alignment:
| Q |
8 |
acatgaactatcacaccactttaaaaacaaagtatgtacaatatcattacctaatttaaatttggacctttattacatcaacataaacccttcattcaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30340818 |
acatgaactatcacaccactttaaaaacaaagtatgtacaatatcattacctaatttaaatttggacctttattacatcaacataaacccttcattcaat |
30340917 |
T |
|
| Q |
108 |
gtcaaggatggcttggtgcaacaagaggtgcagcagaaagaggcattgctgctggtgcaattgcagaaggtggaatagccatagaaccagcactaacatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30340918 |
gtcaaggatggcttggtgcaacaagaggtgcagcagaaagaggcattgctgctggtgcagttgcagaaggtggaatagccatagaaccagcactaacatt |
30341017 |
T |
|
| Q |
208 |
attcccaagacctccttcaac |
228 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30341018 |
attcccaagacctccttcaac |
30341038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University