View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5166_high_16 (Length: 345)
Name: NF5166_high_16
Description: NF5166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5166_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 22829028 - 22829167
Alignment:
| Q |
19 |
gcattaaggctcaatgttataaggagttctttgcattgattgcatgttgatttttaacttgttttgatgaagaatttgaaagaatgatgagggagggatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22829028 |
gcattaaggctcaatgttataaggagttctttgcattgattgaatgttgatttttaacttgttttgatgaagaatttgaaagaatgatgggggagggatg |
22829127 |
T |
 |
| Q |
119 |
gaggccgagaggttagagagaatgagagggagtggagttc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22829128 |
gaggccgagaggttagagagaatgagagagagtggagttc |
22829167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University