View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5166_high_26 (Length: 256)
Name: NF5166_high_26
Description: NF5166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5166_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 238
Target Start/End: Complemental strand, 5817179 - 5816948
Alignment:
| Q |
8 |
tttataaataggtatgcttaatttagttgtgatgttctgcaccactttattctttgtggaaactaaacctagtctgggtaattgacagtgacaa-caacc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
5817179 |
tttataaataggtatgcttaatttagttgtgatgttctgcaccactttattcttcgtggaaactaaacctagtttgggtaattgacagtgacaaacaacc |
5817080 |
T |
|
| Q |
107 |
atggtgttcgtcgttccatccaccagaaaaatcttatccctagacataaaccctaacaccaccactctccataaccttaagctcttaattgaacaatttc |
206 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
5817079 |
atggtgttcgtcgttccacccaccggaaaaatcttatccctatacataaaccctaacaccaccactctccataacctcaaactcttaattgaacaatttc |
5816980 |
T |
|
| Q |
207 |
acggtatatcgattgaacaacaacatatattc |
238 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
5816979 |
acggtatatcgattgaacaacaacgtatattc |
5816948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 103 - 177
Target Start/End: Complemental strand, 25167195 - 25167121
Alignment:
| Q |
103 |
aaccatggtgttcgtcgttccatccaccagaaaaatcttatccctagacataaaccctaacaccaccactctcca |
177 |
Q |
| |
|
||||||||| ||| |||||||| ||||| |||||||| | ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25167195 |
aaccatggtattcatcgttccacccaccggaaaaatcctctccctcgacataaaccctaacaccaccactctcca |
25167121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University