View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5166_high_31 (Length: 245)
Name: NF5166_high_31
Description: NF5166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5166_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 23 - 229
Target Start/End: Original strand, 28169013 - 28169218
Alignment:
| Q |
23 |
cagagagtgatgtccctattacctgtatctttaaatccttgaaatgtctaagccaaccatcttctacaaacactcgatctaaccaaattgatgattcaat |
122 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28169013 |
cagagagtgatgtccctattacatgtatctttaaatccttgaaatgtctaagccaaccatcttctacaaacacttgatctaaccaaattgatgattcaaa |
28169112 |
T |
|
| Q |
123 |
tccataccaagtgaattgtctgtccagcaaacaaatttatgtaagtttcatcatagttatccattcaatgaaattcttcatcgcagatgtaatcccttct |
222 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28169113 |
tccataccaagtgaattgtct-tccagcaaacaaatttatgtaagtttcaccatagttatccattcaatgaaattcttcatcgcagatgtaatcccttct |
28169211 |
T |
|
| Q |
223 |
ttattat |
229 |
Q |
| |
|
||||||| |
|
|
| T |
28169212 |
ttattat |
28169218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University