View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5166_high_37 (Length: 226)
Name: NF5166_high_37
Description: NF5166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5166_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 13 - 148
Target Start/End: Complemental strand, 11723169 - 11723034
Alignment:
| Q |
13 |
gattattctatgtggtagtttttgggtttttcttaatttgtagtactgaagtgttttatggggagttatggtttgttcttgttgctgcctcctgttgctt |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11723169 |
gattatgctatgtggtagtttttgggtttttcttaatctgtagtactgaagtgttttatggggagttatgatttgttcttgttgctgcctcctgttgctt |
11723070 |
T |
|
| Q |
113 |
ttacaagttgtaattgtttggtggactaagcgtgtc |
148 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11723069 |
ttacaagttgtaattgtttggtggactaatcgtgtc |
11723034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 67 - 142
Target Start/End: Original strand, 11594214 - 11594289
Alignment:
| Q |
67 |
tttatggggagttatggtttgttcttgttgctgcctcctgttgct-tttacaagttgtaattgtttggtggactaag |
142 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
11594214 |
tttatgaggagttatggtttgttcttgttgctgcct-ctgttgctctttaccagttgtaattgtggggtggactaag |
11594289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 11 - 72
Target Start/End: Original strand, 11613560 - 11613620
Alignment:
| Q |
11 |
tagattattctatgtggtagtttttgggtttttcttaatttgtagtactgaagtgttttatg |
72 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
11613560 |
tagattatgctatgtggtagtttttgg-tttttcttaaactgtagtactgaagtgttttatg |
11613620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 67 - 142
Target Start/End: Original strand, 11606130 - 11606205
Alignment:
| Q |
67 |
tttatggggagttatggtttgttcttgttgctgcctcctgttgc-ttttacaagttgtaattgtttggtggactaag |
142 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
11606130 |
tttatgaggagttatggtttgttcttgttgctgcct-atgttgctttttacctgttgtaattgtggggtggactaag |
11606205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University