View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5166_low_22 (Length: 291)
Name: NF5166_low_22
Description: NF5166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5166_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 47 - 278
Target Start/End: Original strand, 41757435 - 41757666
Alignment:
| Q |
47 |
ccatcaccatctaagcgatcagttttggctttcttcgccggtggggttcatgggcccgttaggcctgttctacttgaacattgggaacacaaagatgaag |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41757435 |
ccatcaccatctaagcgatcagttttggctttcttcgccggtggggttcatgggcccgttaggcctgttctacttgaacattgggaacacaaagatgaag |
41757534 |
T |
|
| Q |
147 |
atcttcaagttcacaagtaccttccaaagggtgtgtcttactatgatatgttgagaaaaagcaagttctgtctttgtcctagtgggtacgaggttgcaag |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41757535 |
atcttcaagttcacaagtaccttccaaagggtgtgtcttactatgatatgttaagaaaaagcaagttctgtctttgtcctagtgggtacgaggttgcaag |
41757634 |
T |
|
| Q |
247 |
tccaagagtggtggaagcaatatacacaggtt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41757635 |
tccaagagtggtggaagcaatatacacaggtt |
41757666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 46 - 278
Target Start/End: Original strand, 41765517 - 41765749
Alignment:
| Q |
46 |
accatcaccatctaagcgatcagttttggctttcttcgccggtggggttcatgggcccgttaggcctgttctacttgaacattgggaacacaaagatgaa |
145 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |||||| |||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41765517 |
accatcaccatctaagagatcaattttggctttcttcgctggtgggcttcatggggatattaggaatgttctacttgaacattgggaacacaaagatgaa |
41765616 |
T |
|
| Q |
146 |
gatcttcaagttcacaagtaccttccaaagggtgtgtcttactatgatatgttgagaaaaagcaagttctgtctttgtcctagtgggtacgaggttgcaa |
245 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
41765617 |
gatattcaagttcacaagtaccttccaaagggtgtgtcttactatgctatgttgagaaaaagcaagttttgtctttgtcctagtgggtgggaggttgcaa |
41765716 |
T |
|
| Q |
246 |
gtccaagagtggtggaagcaatatacacaggtt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41765717 |
gtccaagagtggtggaagcaatatacacaggtt |
41765749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 156 - 252
Target Start/End: Complemental strand, 26973235 - 26973139
Alignment:
| Q |
156 |
ttcacaagtaccttccaaagggtgtgtcttactatgatatgttgagaaaaagcaagttctgtctttgtcctagtgggtacgaggttgcaagtccaag |
252 |
Q |
| |
|
|||| ||||| |||||||||||||| ||||||||||| ||| ||||||| |||||||||||||| ||||||||||| || ||||| || |||||||| |
|
|
| T |
26973235 |
ttcaaaagtatcttccaaagggtgtttcttactatgaaatgctgagaaagagcaagttctgtctctgtcctagtggttatgaggtggctagtccaag |
26973139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University