View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5166_low_33 (Length: 245)

Name: NF5166_low_33
Description: NF5166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5166_low_33
NF5166_low_33
[»] chr4 (1 HSPs)
chr4 (23-229)||(28169013-28169218)


Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 23 - 229
Target Start/End: Original strand, 28169013 - 28169218
Alignment:
23 cagagagtgatgtccctattacctgtatctttaaatccttgaaatgtctaagccaaccatcttctacaaacactcgatctaaccaaattgatgattcaat 122  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||     
28169013 cagagagtgatgtccctattacatgtatctttaaatccttgaaatgtctaagccaaccatcttctacaaacacttgatctaaccaaattgatgattcaaa 28169112  T
123 tccataccaagtgaattgtctgtccagcaaacaaatttatgtaagtttcatcatagttatccattcaatgaaattcttcatcgcagatgtaatcccttct 222  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
28169113 tccataccaagtgaattgtct-tccagcaaacaaatttatgtaagtttcaccatagttatccattcaatgaaattcttcatcgcagatgtaatcccttct 28169211  T
223 ttattat 229  Q
    |||||||    
28169212 ttattat 28169218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University