View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5166_low_38 (Length: 237)
Name: NF5166_low_38
Description: NF5166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5166_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 56068377 - 56068596
Alignment:
| Q |
1 |
attaagtatagtgatgatttgtatttttgttttgagattgagaatatatatacatgatacaaattaattttggtgatgatttggaatacatttgaannnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56068377 |
attaagtatagtgatgatttgtatttttgttttgagattgagaatatatatacatgatacaaattaattttggtgatgatttggaatacatttgaatttt |
56068476 |
T |
|
| Q |
101 |
nnnnctgcaaaagcaggaagtaagtttggtaaaatcacggattttgttccgtagtttttgtcaaaattgtagtgactcaccatgattccgttaataaact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
56068477 |
tttgctgcaaaagcaggaagtaagtttggtaaaatcacggattttgttccgtagtttttgtcaaaattgtagtgactcatcatgattcc---attaaact |
56068573 |
T |
|
| Q |
201 |
ttgggaaactcaacctacacttt |
223 |
Q |
| |
|
|||| |||||||||| ||||||| |
|
|
| T |
56068574 |
ttggaaaactcaacccacacttt |
56068596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University