View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5166_low_44 (Length: 210)
Name: NF5166_low_44
Description: NF5166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5166_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 20 - 157
Target Start/End: Complemental strand, 30214775 - 30214638
Alignment:
| Q |
20 |
gaacggacgaaggggctgactgaagctatgtatgtatagttgtcattgaatgtagacacaatattcaacttgaattaattgtaagatcattcatttggtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
30214775 |
gaacggacgaaggggctgactgaagctatgtatgtatagttgtcattgaatgcagacacaatattcaactggaattaattgtaagatcattgatttggtg |
30214676 |
T |
|
| Q |
120 |
cattttacgtcacagaaaagttcaaaactgagaaaaaa |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30214675 |
cattttacgtcacagaaaagttcaaaactgagagaaaa |
30214638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 195
Target Start/End: Complemental strand, 30214613 - 30214575
Alignment:
| Q |
157 |
atgtctgaatttaattaatagggttgagtgtgcaaatgt |
195 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30214613 |
atgtctgaatttaattaatagagttgagtgtgcaaatgt |
30214575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University