View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5166_low_5 (Length: 451)
Name: NF5166_low_5
Description: NF5166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5166_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 87 - 292
Target Start/End: Complemental strand, 2501684 - 2501479
Alignment:
| Q |
87 |
aggtgcagtaaactccaagtcaaagaaaggaccttcatcatcattgtcgtcgctgctttcagcggtggtgaggatagtagtggtgttaacggtggtggta |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2501684 |
aggtgcagtaaactccaagtcaaagaaaggaccttcatcatcattgtcgtcgctgctttcagcggtggtgaggatagtagtggtgttaacgttggtggtg |
2501585 |
T |
 |
| Q |
187 |
gttgtggagtcagaagaaggagagagaccaacaacagcaccaccacctcgccagtatttgagcaagctaaaagcttccatcgttgggagagccagtatag |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2501584 |
gttgtggagtcagaagaaggagagagaccaacaacagcaccaccacctcgccagtatttgagcaagctaaaagcttccatcgttgggagagccagtatag |
2501485 |
T |
 |
| Q |
287 |
tatagt |
292 |
Q |
| |
|
|||||| |
|
|
| T |
2501484 |
tatagt |
2501479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 355 - 434
Target Start/End: Complemental strand, 2501416 - 2501337
Alignment:
| Q |
355 |
tattattttggatggggaatgcaatagtgaagggtgtgacagaagaaaatttattgaaatttgaataatgaaatgaaaat |
434 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2501416 |
tattattttggatggggaatgcaatagtgaagggtgtgacagaagaaaatttattgaaatttgaataatgaaatgaaaat |
2501337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University