View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5167_high_4 (Length: 306)
Name: NF5167_high_4
Description: NF5167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5167_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 50 - 289
Target Start/End: Original strand, 1541327 - 1541580
Alignment:
| Q |
50 |
agtacatgtacacctttttacgatagctaggtggaacctatatttgtaacttctatattctactgaataatttttacag-ccatgaaacaaacaccgcct |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1541327 |
agtacatgtacacctttttacgatagctaggtggaacctatatttgtaacttctatattctagtgaataatttttacaaaccatgaaacaaacaccgcct |
1541426 |
T |
|
| Q |
149 |
tacggtatcgtattcctacccagcatgttatctcatctcaatcatcaacggaagaaca-------------tagctcccctcttttgttttatgaatttt |
235 |
Q |
| |
|
||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1541427 |
tactgtatcgtattgctacccagcatgttatctcatctcaatcatcaacggaagaacatagctcatttttttagctcccctcttttgttttatgaatttt |
1541526 |
T |
|
| Q |
236 |
gttcaaatcatatagctaacttcatgtttttaaaccctttaatggatggtatct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1541527 |
gttcaaatcatatagctaacttcatgtttttaaaccctttaatgaatggtatct |
1541580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 1541252 - 1541303
Alignment:
| Q |
1 |
catggttagtttcatgttgctttccaacacaagttttcattctttatggagt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1541252 |
catggttagtttcatgttgctttccaacacaagttttcattctttatggagt |
1541303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University