View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5167_low_8 (Length: 219)
Name: NF5167_low_8
Description: NF5167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5167_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 127 - 184
Target Start/End: Complemental strand, 1540925 - 1540868
Alignment:
| Q |
127 |
agattcatttttaaaatataaaccaaagcgaactaagctacaatacatgcatatattt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1540925 |
agattcatttttaaaatataaaccaaagcgaactaagctacaatacatgcatatattt |
1540868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 1541054 - 1541022
Alignment:
| Q |
1 |
atacacccaacttagtttcatttaatgatgtaa |
33 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
1541054 |
atacacccaacttagtttcatttcatgatgtaa |
1541022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University