View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5168-Insertion-10 (Length: 98)
Name: NF5168-Insertion-10
Description: NF5168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5168-Insertion-10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 7e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 7e-40
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 5302787 - 5302697
Alignment:
| Q |
8 |
caatccactttgtctagtttttgttgccatatcagaagctttcatacttggtgaaccactcaaagttggaacgtatgaatacttttccttc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5302787 |
caatccactttgtctagtttttgttgccatttcagaagctttcatacttggtgaaccactcaaagttggaacgtaagaatacttttccttc |
5302697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 5e-19; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 5e-19
Query Start/End: Original strand, 24 - 95
Target Start/End: Complemental strand, 29222751 - 29222680
Alignment:
| Q |
24 |
gtttttgttgccatatcagaagctttcatacttggtgaaccactcaaagttggaacgtatgaatacttttcc |
95 |
Q |
| |
|
||||| ||||||||||| || || |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29222751 |
gttttcgttgccatatctgacactatcatacttggtgaaccactcaaagttggaacgtatgaatatttttcc |
29222680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 5e-16
Query Start/End: Original strand, 24 - 98
Target Start/End: Complemental strand, 38850681 - 38850607
Alignment:
| Q |
24 |
gtttttgttgccatatcagaagctttcatacttggtgaaccactcaaagttggaacgtatgaatacttttccttc |
98 |
Q |
| |
|
|||||||||||| | |||||||| | ||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
38850681 |
gtttttgttgcctttgcagaagctatgatacttggtgaaccactaacggttggaacgtatgaatacttttccttc |
38850607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 29148124 - 29148188
Alignment:
| Q |
25 |
tttttgttgccatatcagaagctttcatacttggtgaaccactcaaagttggaacgtatgaatac |
89 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||| ||||| | | |||||||||||||||||| |
|
|
| T |
29148124 |
ttttcgttgccatatcagaggctatcatacttggcgaaccgttaagggttggaacgtatgaatac |
29148188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University