View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5168_low_4 (Length: 292)
Name: NF5168_low_4
Description: NF5168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5168_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 42552996 - 42553277
Alignment:
| Q |
1 |
agtgttccgtgaagtgattcgtctttcgttgaggtgtaattgattggaactgctacttcgtgaacgcaggtgcgttctgaactgcggcannnnnnnggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
42552996 |
agtgttccgtgaagtgattcgtctttcgttgaggtgtaattgattggaactgctacttcgtgaacgcaggtgcattctgaactgcggcatttttttggtt |
42553095 |
T |
|
| Q |
101 |
gcgaagaagtgtcgccgccgtcggcggtggacaccggttccggttcacttcgttttccgagtgttgttgattgctgctccattgctggttcttgctccat |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42553096 |
gtgaagaagtgtcgccgccgtcggcggtggaaaccggttccggttcacttcgttttccgagtgttgttgattcctgctccattgctggttcttgctccat |
42553195 |
T |
|
| Q |
201 |
tttcgcctgagattaaaatttgagcggaaaatggagttcgattttgattgagagagataaaccctagcttcgtttctctgtg |
282 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42553196 |
tttcgcctgagatgaaaatttgagcggaaaatggagttcgattttgattgagagagataaaccctagcttcgtttccctgtg |
42553277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 29403730 - 29403648
Alignment:
| Q |
1 |
agtgttccgtgaagtgattcgtctttcgttgaggtgtaattgattggaactgctacttcgtgaacgcaggtgcgttctgaact |
83 |
Q |
| |
|
|||||||||| ||||| ||||||||| |||||| |||||| |||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
29403730 |
agtgttccgtaaagtgcttcgtcttttgttgagatgtaatcgattggtactgctactttgtgaacgcaggtgcgttctgaact |
29403648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University