View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5169-Insertion-11 (Length: 90)
Name: NF5169-Insertion-11
Description: NF5169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5169-Insertion-11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 50; Significance: 3e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 41331176 - 41331127
Alignment:
| Q |
8 |
ccatgatcgatgccattgtcgatactcttcacggaccaaacttcattttc |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41331176 |
ccatgatcgatgccattgtcgatactcttcacggaccaaacttcattttc |
41331127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 82
Target Start/End: Complemental strand, 41331104 - 41331072
Alignment:
| Q |
50 |
tcattttccatgtaaaatagacctgtgtattct |
82 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
41331104 |
tcattttccatgtaaaatagacctgtgcattct |
41331072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University