View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5169-Insertion-11 (Length: 90)

Name: NF5169-Insertion-11
Description: NF5169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5169-Insertion-11
NF5169-Insertion-11
[»] chr8 (2 HSPs)
chr8 (8-57)||(41331127-41331176)
chr8 (50-82)||(41331072-41331104)


Alignment Details
Target: chr8 (Bit Score: 50; Significance: 3e-20; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 41331176 - 41331127
Alignment:
8 ccatgatcgatgccattgtcgatactcttcacggaccaaacttcattttc 57  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
41331176 ccatgatcgatgccattgtcgatactcttcacggaccaaacttcattttc 41331127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 82
Target Start/End: Complemental strand, 41331104 - 41331072
Alignment:
50 tcattttccatgtaaaatagacctgtgtattct 82  Q
    ||||||||||||||||||||||||||| |||||    
41331104 tcattttccatgtaaaatagacctgtgcattct 41331072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University