View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5169-Insertion-13 (Length: 125)
Name: NF5169-Insertion-13
Description: NF5169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5169-Insertion-13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 39697799 - 39697682
Alignment:
| Q |
8 |
ccttgatctagtccatctccttgaaaaaggatcataacctgcctcccctgctttcaatgctttattaactggctttaaatcagaagcatttttgaagttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39697799 |
ccttgatctagtccatctccttgaaaaaggatcataacctgcctcccctgctttcaatgctttattaactggctttaaatcagaagcatttttgaagttc |
39697700 |
T |
|
| Q |
108 |
tcaaccctgttctttctg |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39697699 |
tcaaccctgttctttctg |
39697682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 35692768 - 35692654
Alignment:
| Q |
8 |
ccttgatctagtccatctccttgaaaaaggatcataacctgcctcccctgctttcaatgctttattaactggctttaaatcagaagcatttttgaagttc |
107 |
Q |
| |
|
||||||||| ||||| ||||||||||| |||||||||||||| |||||| ||||||| | |||| |||| | || ||||||||||| |||||||| |
|
|
| T |
35692768 |
ccttgatcttgtccacctccttgaaaatggatcataacctgcatccccttctttcaaacc--ggttaa-tggcctcaattcagaagcattcttgaagttt |
35692672 |
T |
|
| Q |
108 |
tcaaccctgttctttctg |
125 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
35692671 |
tcaaccctgttttttctg |
35692654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University