View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5169-Insertion-15 (Length: 43)
Name: NF5169-Insertion-15
Description: NF5169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5169-Insertion-15 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 36; Significance: 0.000000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 43
Target Start/End: Complemental strand, 2564675 - 2564640
Alignment:
| Q |
8 |
acatcttcatgggattgttacctagtatgtagtcca |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2564675 |
acatcttcatgggattgttacctagtatgtagtcca |
2564640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.0000000006
Query Start/End: Original strand, 8 - 43
Target Start/End: Complemental strand, 2574569 - 2574534
Alignment:
| Q |
8 |
acatcttcatgggattgttacctagtatgtagtcca |
43 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2574569 |
acatcttcatgggattgtttcctagtatgtagtcca |
2574534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University