View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5169-Insertion-17 (Length: 173)
Name: NF5169-Insertion-17
Description: NF5169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5169-Insertion-17 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 2e-66; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 27 - 173
Target Start/End: Original strand, 43119647 - 43119794
Alignment:
| Q |
27 |
atttatacacaagaaa-ctataagaattgatattgccatttttattaagtaatagagatgatctacactcgtgaataaaacattgatgaatgatgatcgt |
125 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43119647 |
atttatacacaaaaaaactataagaattgatattgccatttttattaagtaatagaaatgatctacactcgtgaataaaacatttatgaatgatgatcgt |
43119746 |
T |
|
| Q |
126 |
cgtgcccacctaccagacctgaatcctcttctttcaactctccttcac |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43119747 |
cgtgcccacctaccagacctgaatcctcttctttcaactctccttcac |
43119794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 66 - 173
Target Start/End: Original strand, 43119461 - 43119568
Alignment:
| Q |
66 |
tttattaagtaatagagatgatctacactcgtgaataaaacattgatgaatgatgatcgtcgtgcccacctaccagacctgaatcctcttctttcaactc |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43119461 |
tttattaagtaatagagatgatctacactcgtgaataaaacattgatgaatgatgatggtcgtgcccacctaccagacctaaatcctcttctttcaactc |
43119560 |
T |
|
| Q |
166 |
tccttcac |
173 |
Q |
| |
|
|||||||| |
|
|
| T |
43119561 |
tccttcac |
43119568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.0000000009
Query Start/End: Original strand, 25 - 68
Target Start/End: Original strand, 43119322 - 43119366
Alignment:
| Q |
25 |
atatttatacacaagaaa-ctataagaattgatattgccattttt |
68 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
43119322 |
atatttatacacaaaaaaactataagaattgatattgccattttt |
43119366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University