View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5169-Insertion-6 (Length: 387)
Name: NF5169-Insertion-6
Description: NF5169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5169-Insertion-6 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 336; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 8 - 387
Target Start/End: Complemental strand, 34609325 - 34608955
Alignment:
| Q |
8 |
tgtttctcttcttagaagctttctttgcaagttttattgccttcatcttttgagcagaatccctaaaaccttctccaggcacaacaacgggaagtggttg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34609325 |
tgtttctcttcttagaagctttctttgcaagttttattgccttcatcttttgagcagaatccctaaaaccttctccaggcacaacaacgtgaagtggttg |
34609226 |
T |
|
| Q |
108 |
ctgaaccgatctggaaaaacgtgacactgatctactcaacctctgcttcttcatcttgctaggcttgtcaccatgatcagcatcaatgttcgttgtttct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34609225 |
ctgaaccgatctggaaaaacgtgacactgatctactcaacctctgcttcttcatcttgctaggcttgtcaccatgatcagcatcaatgctcgttgtttct |
34609126 |
T |
|
| Q |
208 |
ggtgatcgctctctttttctaccttgccttgatggtagttgttgggttaacgagtttttctttgtctccgttgaagcttcttgttgttcttgtgttgatt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
34609125 |
ggtgatcgctctctttttctaccttgccttgatggtagttgttgggttaacgagtttttctttgtcaccgttgaagcttc---------ttgtgttgatt |
34609035 |
T |
|
| Q |
308 |
cagtatccatggcgaaatcgtttggtggtgtttctccaatgctatgctgaaccattgttgttgttttctatttgccctaa |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34609034 |
cagtatccatggcgaaatcgtttggtggtgtttctccaatgctatgctgaaccattgttgttgttttctatttgccctaa |
34608955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 32397630 - 32397555
Alignment:
| Q |
8 |
tgtttctcttcttagaagctttctttgcaagttttattgccttcatcttttgagcagaatccctaaaaccttctcc |
83 |
Q |
| |
|
||||||||||||| || | | ||| |||||||| ||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
32397630 |
tgtttctcttcttggatgatcccttcgcaagtttgattgctttgatcttttgagcagaatccctaaggccttctcc |
32397555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 8 - 92
Target Start/End: Complemental strand, 6130984 - 6130900
Alignment:
| Q |
8 |
tgtttctcttcttagaagctttctttgcaagttttattgccttcatcttttgagcagaatccctaaaaccttctccaggcacaac |
92 |
Q |
| |
|
||||||||||||| |||| | ||| |||||||| ||||| || |||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
6130984 |
tgtttctcttcttggaagatcccttcgcaagtttaattgctttgatcttttgagcagaatccctaaggccttctccaggaacaac |
6130900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University