View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5169_high_21 (Length: 259)
Name: NF5169_high_21
Description: NF5169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5169_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 22186890 - 22186831
Alignment:
| Q |
1 |
ttttcttggaagctaaactcttttcagcttgaagctcatgtgttagtagtataaatatgc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22186890 |
ttttcttggaagctaaactcttttcagcttgaagctcatgtgttagtagtatatatatgc |
22186831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 143 - 249
Target Start/End: Complemental strand, 22186748 - 22186648
Alignment:
| Q |
143 |
ctgaatttagatatgttaattgattttgaacacatgtannnnnnnnnnnnnnnnaaattaccataatcaaagtattaaaattcaaccattatatctttgt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22186748 |
ctgaatttagatatgttaattgattttgaacacatgtattttttttta------aaattaccataatcaaagtattaaaattcaaccattatatctttgt |
22186655 |
T |
 |
| Q |
243 |
gtctgtg |
249 |
Q |
| |
|
||||||| |
|
|
| T |
22186654 |
gtctgtg |
22186648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University