View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5169_low_11 (Length: 369)

Name: NF5169_low_11
Description: NF5169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5169_low_11
NF5169_low_11
[»] chr7 (1 HSPs)
chr7 (162-263)||(42859345-42859446)


Alignment Details
Target: chr7 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 162 - 263
Target Start/End: Original strand, 42859345 - 42859446
Alignment:
162 taatcgaaatttacattaacctctcttcaagatactagcgggcttgaacccaaaactttcaaatttaacatccatctttttaccactaaattaaacctag 261  Q
    ||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
42859345 taatcgaaatttacattaacctctcttgaagatactagcgggtttgaacccaagactttcaaatttaacatccatctttttaccactaaattaaacctag 42859444  T
262 ag 263  Q
    ||    
42859445 ag 42859446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University