View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5169_low_22 (Length: 259)

Name: NF5169_low_22
Description: NF5169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5169_low_22
NF5169_low_22
[»] chr7 (2 HSPs)
chr7 (1-60)||(22186831-22186890)
chr7 (143-249)||(22186648-22186748)


Alignment Details
Target: chr7 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 22186890 - 22186831
Alignment:
1 ttttcttggaagctaaactcttttcagcttgaagctcatgtgttagtagtataaatatgc 60  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
22186890 ttttcttggaagctaaactcttttcagcttgaagctcatgtgttagtagtatatatatgc 22186831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 143 - 249
Target Start/End: Complemental strand, 22186748 - 22186648
Alignment:
143 ctgaatttagatatgttaattgattttgaacacatgtannnnnnnnnnnnnnnnaaattaccataatcaaagtattaaaattcaaccattatatctttgt 242  Q
    ||||||||||||||||||||||||||||||||||||||                ||||||||||||||||||||||||||||||||||||||||||||||    
22186748 ctgaatttagatatgttaattgattttgaacacatgtattttttttta------aaattaccataatcaaagtattaaaattcaaccattatatctttgt 22186655  T
243 gtctgtg 249  Q
    |||||||    
22186654 gtctgtg 22186648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University