View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5171-Insertion-9 (Length: 111)
Name: NF5171-Insertion-9
Description: NF5171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5171-Insertion-9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 8 - 111
Target Start/End: Original strand, 45672745 - 45672848
Alignment:
| Q |
8 |
aaggcatcaaagatcgaagcacattcaagtattcattcatttgttttcttcgattgcgttcaacagtaatatgagtcatcctttgattttcaatctcttc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45672745 |
aaggcatcaaagatcgaagcacattcaagtactcattcatttgttttcttcgattgcgttcaacagtaatatgagtcatcctttgattttcaatctcctc |
45672844 |
T |
|
| Q |
108 |
tttg |
111 |
Q |
| |
|
|||| |
|
|
| T |
45672845 |
tttg |
45672848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 89
Target Start/End: Original strand, 27300931 - 27300980
Alignment:
| Q |
40 |
tcattcatttgttttcttcgattgcgttcaacagtaatatgagtcatcct |
89 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| | ||| ||||||||||| |
|
|
| T |
27300931 |
tcattcatctgttttcttcgattgcgctcaactgcaatgtgagtcatcct |
27300980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University