View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5171_high_2 (Length: 313)
Name: NF5171_high_2
Description: NF5171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5171_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 18 - 297
Target Start/End: Original strand, 10769994 - 10770272
Alignment:
| Q |
18 |
atatatagagagaatatcaatcagatatttctgnnnnnnnntatatcaaacgaatatttattcatcgatagatgtcattgttagttttatactctaagtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10769994 |
atatatagagagaatatcaatcagatatttctcaaaaaaaatata--aaatgaatatttattcatcgatagatgtcattgttagttttatactctaagcg |
10770091 |
T |
 |
| Q |
118 |
agttggtcgttattgacgagtctgagaaaatcgttgata-tgcttataattggggcctggttcctctcccgtcaaatccggttcgccccgcccgtttgcc |
216 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||| || |||| ||||||||||| ||||||||| | ||||| ||||| |||||| ||||||||| |
|
|
| T |
10770092 |
agttggtcgttattgacgagaatgaggaaatcgttgatattgtttatgattggggcctgattcctctcctgccaaatgcggtttgccccgtccgtttgcc |
10770191 |
T |
 |
| Q |
217 |
nnnnnnngctcgcgggccggccggttttggacgggtcggcccaatctgtccggccctacattgtatgtccccagccttcat |
297 |
Q |
| |
|
|||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
10770192 |
tttttttgctcgcaggccgaccgattttggacgggtcggcccaatctgtccggccctacattgtatgtctcaagccttcat |
10770272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 228 - 271
Target Start/End: Original strand, 43148613 - 43148656
Alignment:
| Q |
228 |
gcgggccggccggttttggacgggtcggcccaatctgtccggcc |
271 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
43148613 |
gcgggccggccggttttggacggatcggctcaatctgtccggcc |
43148656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 229 - 275
Target Start/End: Original strand, 22190168 - 22190214
Alignment:
| Q |
229 |
cgggccggccggttttggacgggtcggcccaatctgtccggccctac |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22190168 |
cgggccggccggttttggacgggtcggcccaatctgtccagccctac |
22190214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University