View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5171_high_3 (Length: 304)
Name: NF5171_high_3
Description: NF5171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5171_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 13 - 289
Target Start/End: Complemental strand, 29448612 - 29448336
Alignment:
| Q |
13 |
aatatcaaactcttactgaaatggctgtacagaaggatgaacagcctccactggaattagaacctgcaaagctgttaagttttagcatctctgataccga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||| |
|
|
| T |
29448612 |
aatatcaaactcttactgaaatggctgtacagaaggatgaacagcctccactggaattagaacctgcaaagctgttaaattttcgcatctctgacaccga |
29448513 |
T |
 |
| Q |
113 |
tggaacgaaaagtaaaacactgagcagtttaggtggtattatgatgcaacagaatttagcgaaggaacaaaatcaatctagtgacggtatttcgccaaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29448512 |
aggaacgaaaagtaaaacactgagcagtttaggtggtattatgatgcaacagaatttagcgaaggaacaaaatcaatctagtgacggtatttcgccaaaa |
29448413 |
T |
 |
| Q |
213 |
atagaaagtaatcatcacgaacagcagcataataatgcgaatgctttatatgatcttggtgaccatgaagaagaatc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29448412 |
atagaaagtaatcatcacgaacagcagcataataatgtgaatgctttatatgatcttggtgaccatgaagaagaatc |
29448336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University