View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5171_high_5 (Length: 246)
Name: NF5171_high_5
Description: NF5171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5171_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 7691782 - 7691565
Alignment:
| Q |
18 |
agtataaaggattaaacgtaaagtgttagtttaagcacgaattcgaatcgcgaaaagcttttaaaaactgccactaaccgctctcactttcatcaacaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7691782 |
agtataaaggattaaacgtaaagtgttagtttaagcacgaattcaaatcgcgaaaagcttttaaaaactgccactaaccgctctcactttcatcaacaga |
7691683 |
T |
|
| Q |
118 |
acagaacatcacttttctattatgatcttcttctaacag-nnnnnnnnntgaagatactactcattctcatttcactttatgctctctctttcttcccaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7691682 |
acagaacatcacttttctattatgatcttcttctaacagaaaaaaaaaatgaagatactactcattctcatttcactttatgttctctctttcttcccaa |
7691583 |
T |
|
| Q |
217 |
tatcatactccacaggtt |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7691582 |
tatcatactccacaggtt |
7691565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 166 - 234
Target Start/End: Complemental strand, 13890360 - 13890292
Alignment:
| Q |
166 |
tgaagatactactcattctcatttcactttatgctctctctttcttcccaatatcatactccacaggtt |
234 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
13890360 |
tgaagatactagtcattctcatttcactctatactctctctttcttcccattatcatatcccacaggtt |
13890292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 166 - 234
Target Start/End: Complemental strand, 14030485 - 14030417
Alignment:
| Q |
166 |
tgaagatactactcattctcatttcactttatgctctctctttcttcccaatatcatactccacaggtt |
234 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
14030485 |
tgaagatactagtcattctcatttcactctatactctctctttcttcccattatcatatcccacaggtt |
14030417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University