View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5171_high_6 (Length: 240)

Name: NF5171_high_6
Description: NF5171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5171_high_6
NF5171_high_6
[»] chr4 (1 HSPs)
chr4 (19-216)||(55484280-55484477)


Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 55484477 - 55484280
Alignment:
19 aatacgtctcaaacaaactttattgaaccatgcacatgattatggggggttatgttagtttttgttgggtccataatgttaatgtgtaaactctctgttg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55484477 aatacgtctcaaacaaactttattgaaccatgcacatgattatggggggttatgttagtttttgttgggtccataatgttaatgtgtaaactctctgttg 55484378  T
119 gatattgtagactatgatggatagttttgatactttggaaccaactaaaataagaatagttagacaaataatcggcttcttcaccataaaataagcac 216  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
55484377 gatattgtatactatgatggatagttttgatactttggaaccaactaaaataagaatagttagacaaataatcggcttcttcagcataaaataagcac 55484280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University