View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5172_low_1 (Length: 383)
Name: NF5172_low_1
Description: NF5172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5172_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 62; Significance: 1e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 298 - 371
Target Start/End: Complemental strand, 46455870 - 46455797
Alignment:
| Q |
298 |
aatgcacaggaggtggtggggattgaactggtggtggcggtgatcgtgttcttcttttgggtgcttcatgatga |
371 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46455870 |
aatgcacaggaggtggtgaggattgaactggtggcggcggtgatcgtgttcttcttttgggtgcttcattatga |
46455797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 22 - 53
Target Start/End: Complemental strand, 46456236 - 46456205
Alignment:
| Q |
22 |
gagaatgtactggtggaggaggggaatgaacc |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46456236 |
gagaatgtactggtggaggaggggaatgaacc |
46456205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University